Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P094G07
Clone ID P094G07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P094G07
Sequence
CGCCACCTCCCCAGCATTGGAGCCCGAGTTTTGCGGCATGAGCCGGCGCACCTGCAGTGACCTGCGCCGGCCGTCCTCCT
GTCCCTGCCGTCTTGGCGCGCGGACTACCGTGGACG
Sequence Type mRNA
Unitrap ID UNI11452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4541167..4541282 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019773 (Fbxo5) NM_025995 F-box protein 5 Gene [Source:MGI (curated);Acc:Fbxo5-001]


SPLK-Sequence tag 5SP094G07
Sequence
GTCACTTTTTCCAACGTTTAGGTGAGCAGAGAGAATCAATTGTTTATTTTCTTATTAATTTTTTATCTTTCTTGGCATCT
CAATGAAAGATGCATCGGTTCTATCGTAGAAAATTTCCACCTGAAGGA
Sequence Type genomic DNA
Unitrap ID UNI11452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4542084..4542211 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019773 (Fbxo5) NM_025995 F-box protein 5 Gene [Source:MGI (curated);Acc:Fbxo5-001]


SPLK-Sequence tag 3SP094G07
Sequence
AATCTCTCTTCTCAGAAAAGGTATTATGTCTTGAAGAGAAGAGAGCTCTATCTTAGCAGAGTGTGTCTGTAAAAGAGCAC
CCGAGTCTCCGATAGAAAATAAGAAATTTAGTGTTTTACGGAGGGATTCTTTTGCTCAGCTTTCCTCCTCAGGAAATGCT
TGCTGCCCCCAACTCCCCTCCCCCAGTGGTTTTACAGCCTTGGAGAAACCTTAAAAAATAATTAGAACATTTAAATATTT
TTCAAAGGAGACTTAAAGGTTCTCTCTTGGGATATACTTTCAATCACCTTTCCTCACCCTTGCACAAAGAAGGGATGGTG
TGTGACCTTGCACACATGTCTGGAGACTGAGACTGAAACCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019773


For any suggestions or comments, please send an email to unitrap@crg.es