Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P093G08
Clone ID P093G08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P093G08
Sequence
TCTCTTTCCTTTTGCGGCCATCGGTGGATCGCAGCCG
Sequence Type mRNA
Unitrap ID UNI11664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28951448..28951484 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68715090..68715126 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060938 (Rpl26) NM_009080 ribosomal protein L26 Gene [Source:MGI (curated);Acc:Rpl26-001]


SPLK-Sequence tag 5SP093G08
Sequence
GATCCGCCCTTGCTTCCATGCTCAAGTGGGGGGCAAAATGCAGAGCACCAGAAGCGGTAAATGAGAAGGTAAAGACCGAC
GCTGTGTAGGACCCTCCCGGGATGCTGAAGT
Sequence Type genomic DNA
Unitrap ID UNI29538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68715420..68715530 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060938 (Rpl26) NM_009080 ribosomal protein L26 Gene [Source:MGI (curated);Acc:Rpl26-001]


SPLK-Sequence tag 3SP093G08
Sequence
AGTTTAAAAGTAGGATAGGTGTTACTAATGGCAGAGTCTTCATCTTGTTTTCAGTCTTTAAAGACGAAAAAACCCTCAGA
TGGGAAGGTCTGGAGTAACCGAGCATGATACCTTCCAGTGAACGTTGTGTGCTTTCAGAGTGGAGTTGATGCTGTTTAGG
GAACTGGTTGAGACTTGAAACGTTAAAGGGTCTTCT
Sequence Type genomic DNA
Unitrap ID UNI29538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68715541..68715736 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060938 (Rpl26) NM_009080 ribosomal protein L26 Gene [Source:MGI (curated);Acc:Rpl26-001]

 
Come back to gene ENSMUSG00000060938


For any suggestions or comments, please send an email to unitrap@crg.es