Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12450D11
Clone ID IST12450D11
Vector VICTR76
Project tigm

Sequence tag IST12450D11BBF1
Sequence
CTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCA
Sequence Type genomic DNA
Unitrap ID UNI16970 UNI31371 UNI32303 UNI32304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41026192..41026233 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 50276586..50276627 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103237886..103237927 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032555 (Topbp1) NM_176979 topoisomerase (DNA) II binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920018]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 39574565..39574606 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041014 (Nrg3) NM_008734 neuregulin 3 Gene [Source:MGI Symbol;Acc:MGI:1097165]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 50037320..50037361 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85789632..85789673 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6717871..6717912 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051527 (Usp29) NM_021323 ubiquitin specific peptidase 29 Gene [Source:MGI Symbol;Acc:MGI:1888998]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 17404086..17404127 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116428420..116428461 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033985 (Tesk2) NM_146151 testis-specific kinase 2 Gene [Source:MGI (curated);Acc:Tesk2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102050641..102050682 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 47032863..47032904 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 185647587..185647628 42
NO GENE  

 
Come back to gene ENSMUSG00000033985


For any suggestions or comments, please send an email to unitrap@crg.es