Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P093D08
Clone ID P093D08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P093D08
Sequence
TCCAAGGCTTCNNNTCAGTGGGGCCATGAACCCTAACTGTGCCCGGTGCGGCAAGATCGTGTACCCCACGGAGAAGGTGA
ACTGTCTGGATAAGTACTGGCATAAAGCATGCTTTCACTGCGAGACCTGCAAGATGACCCTGAACATGAAGAACTACAAG
GGTTATGAGAAGAAGCCTTACTGCAATGC
Sequence Type mRNA
Unitrap ID UNI7764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97661106..97668233 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


SPLK-Sequence tag 5SP093D08
Sequence
TGAATCAAATGTCTCAGGGAGCTGGAAGCCACAGAGGTGAGGGCAAGTCTGTTTCCTTCTGGGTGGAGGAGGAAAACCAA
AACCGGCAGCCCGAGTGTCAAAACCAGCCATCAAACCCCTCCTGTCTCATGCCACCCATAGTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP093D08
Sequence
CTAAGGGTTGGTAAGTTCTTCCTCCAGTCTACACTTAATCTTTTGGACTGCTCATTTGTGCCCGTCTGGCCAAACAATGC
CTCCTTGTTTTTTCTTATCCTTGCCACATTAGGCCTGAAGGCNNTGAGCTGGGCTTGTAAGAATCAAGGCTAACGGAGCC
TGCCCTCTCTCACCAGCCTGTGGGCAGTGTTCCTAGCAGGGGATTGGGG
Sequence Type genomic DNA
Unitrap ID UNI7764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97672365..97672573 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es