Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15083C3
Clone ID IST15083C3
Vector VICTR80
Project tigm

Sequence tag IST15083C3HMR1
Sequence
CNGGACTCTCCAGANTAGCTTCCCTACCCCAAGCAAGGTGCTGGCTAGTGCCCTGCTGGCCCGGGGACTGCACTGTGGTT
CCCATGGACTGGCTGTTTCCCTAACCTTTTCCCATTCCCTCTTACTGTGTAATAAACTCGTACATTTTTGTATCTCTCTA
ATTTTGGGGCTTTAAAATACATGGTAGATTTTCGTTTGTTGTTTTTTGTTTGTTTGTTTTGGTGGGGGGNNNNNNNGGTN
ANACAGTGTTTCN
Sequence Type genomic DNA
Unitrap ID UNI32305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 67492519..67492768 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037846 (Rtkn2) NM_001081346 rhotekin 2 Gene [Source:MGI (curated);Acc:Rtkn2-001]


Sequence tag IST15083C3HMF1
Sequence
GTATAATGACGTAAATATATGGAAATATGAGGTCCATTACTTTACATGCTAATTTAAAAACATTTGAAAGCTGGGAGTAG
TGACCCATTATAATCCCAGCACTCCGGGAGGCTGAGGCAGGTGGATCTCTGAGTTCAAGACTAACCTGGTCTACAGAGTG
AGTTCCAGGACAGCCAGGGCTACACAGAGAGAGGTGGTTTTGAAAACCCCAAAACAAACAAGCAAGCAAACAAACTTAAA
AATAAAACAACCAAACATTAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95458031..95458296 266
NO GENE  

 
Come back to gene ENSMUSG00000037846


For any suggestions or comments, please send an email to unitrap@crg.es