Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P096B05
Clone ID P096B05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P096B05
Sequence
GGGCGAGTTCGGCGGGTGCAGGTCCCGGCCTGCGCCTGCGGAGGGCTCAGGCAGAGGGTCGAAGCGAGCGGCGCTCGCGA
CAGACTGCGCTCCGCGATGGTGGGCGTCCCTGGAGCGGCCGCCTTCCAAC
Sequence Type mRNA
Unitrap ID UNI5148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262243..154262372 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60622625..60622754 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070791 (AC140317.2)  


SPLK-Sequence tag 5SP096B05
Sequence
TAGAAATTTCCTATTTCCATTCCCCACCTCCTCCCTGCCTCATCCTCCATTCCCTTAATTTAATTTTTGTCAAGTCCATC
CTTCCCCTGATTTAAGTTCTCCCCCAGTTAAGATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP096B05
Sequence
TCTAGTATTAAGGTGCACGTGAGTGNNNTGCCCAAGGAAGCTAGAGGCTTTTGATCCCCTGCAGCCACTTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000070791


For any suggestions or comments, please send an email to unitrap@crg.es