Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10461E5
Clone ID IST10461E5
Vector VICTR76
Project tigm

Sequence tag IST10461E5HMR1
Sequence
TTTTAGTTGCTCCTTGCAATCGTCTTGCTCTCTTGGGGATTCGTCATCTATGCATCGACTGTAGCTGCACGACGACAACT
ACAGAAGGAGTTTCCAGACAAGTTCTTCTGAACGAACTTTTGTAATTCTTAGCAAACACTTCTTTTCTTCAGATGGCACC
TATGTANACTCAAAGTAAAATTCACAATACAAATTTGCGTGTGGCCTTTTGTGATAAGCGTTC
Sequence Type genomic DNA
Unitrap ID UNI13990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40217065..40217286 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028407 (2010003O02Rik) RIKEN cDNA 2010003O02 gene Gene [Source:MGI Symbol;Acc:MGI:1913684]


Sequence tag IST10461E5BBF1
Sequence
AAAGGAGGGGAGGAAAAGCAAAAANAAGAAATCAATGTGCCGGGTCCTTTCCCTGTGTAGCCCGAGCAAGCAGCTACAGG
TGGAAAGGCATCACATGCCTCTAACACAGTGCAGCCCAGAGGCAAGCAGGCCTGCAACCCCTGACGTCAGAGGCGGAAAA
GCGTGTCCTCCAGGAAGAGGCGGAGCCGAGGGCAGGGCGTGAACGCTCAATTTAGGAATGGGTTCTGGAGTTCCAAGCTG
CGAGCCAACAGTCTACCTTNNGCTNGCGGGCCCTGCCATGGTGCGCTCTGGAGCTCCGCTCTGCTCGGTACCTACCAGGG
AGTAAGTCCNGTCCAGGCTTCGGCGACTCATCGGCCTCATGGTAAGGGAGCAGCGGGGACGGGGTGGCAAGGGCCCTACA
GCCTGCTCGCGGGCGCATTGCACCCCGATGCAGCAGCNNTTTTTCAGCGGNNNTCTGCGCGCTCCCGCGGGCTTNNGCCN
NNNGTTGGNACACATCACGTGATCCGGGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40216560..40217067 474

 
Come back to gene Mm.251548


For any suggestions or comments, please send an email to unitrap@crg.es