Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P078E06
Clone ID P078E06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P078E06
Sequence
ATCCTTTGGAACTTGTGCTGAAAAAAGAAGAGTCAGCAAATACTACTGAAAGTGCAATATTTGATTATCACTGCGAG
Sequence Type mRNA
Unitrap ID UNI854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102833059..102833135 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es