Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12818D11
Clone ID IST12818D11
Vector VICTR76
Project tigm

Sequence tag IST12818D11HMR1
Sequence
NTTCATAGCAACTTTGAAACCNGTGTGGGCTGCTCCAGTTGCATGGA
Sequence Type genomic DNA
Unitrap ID UNI32310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121035572..121035616 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032741 (Tpcn1) NM_145853 two pore channel 1 Gene [Source:MGI Symbol;Acc:MGI:2182472]


Sequence tag IST12818D11HMF1
Sequence
AAGTAAAGGATGACTTTGAACATCTGATCCCCCTGCCTCTGCTGGGATTACAACTGTGCATCACACCTGGTTTATAGGGA
ACTGGGGCCTGAACCCAGGGCTGTGTGCTAGACCTCACTCTACCTGGTAAGCCACAGCCCACACTGCCACTGTGTTTCAA
CATTAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121035615..121035791 177
NO GENE  

 
Come back to gene ENSMUSG00000032741


For any suggestions or comments, please send an email to unitrap@crg.es