Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14782D7
Clone ID IST14782D7
Vector VICTR76
Project tigm

Sequence tag IST14782D7BBF1
Sequence
TCACAACCATCTGTATTGGGATCTGATGCCCTCTTCT
Sequence Type genomic DNA
Unitrap ID UNI27956 UNI32311 UNI32312 UNI32313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5822752..5822788 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 34669607..34669643 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022832 (Ropn1) NM_030744 ropporin, rhophilin associated protein 1 Gene [Source:MGI (curated);Acc:Ropn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 61958315..61958351 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 85377433..85377469 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059439 (Bcas3) NM_138681 breast carcinoma amplified sequence 3 Gene [Source:MGI (curated);Acc:Bcas3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38842610..38842646 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051736 (1700025K23Rik) NM_183254 RIKEN cDNA 1700025K23 gene Gene [Source:MGI Symbol;Acc:MGI:1913587]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 35012541..35012577 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39637037..39637073 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125272995..125273031 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134773714..134773750 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52086730..52086766 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147408852..147408888 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91077729..91077765 37
NO GENE  

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es