Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14940F5
Clone ID IST14940F5
Vector VICTR76
Project tigm

Sequence tag IST14940F5BBF1
Sequence
CTTAAAGAATCATAGCAAGCCATCAACAGTCTCAACAGGAGCTTTAGGGACAGTCAGCAGAGATAGGAGTGGAGAACTGC
ATACTCAAGGGGTGAAGAGCCTGTCACCCTGTTGAAAACAGTTTCTCAGAGGCAGCATCATCGTCGTTGTCGTCGTCGTC
GCTTGGGCCNNCNNTCNNTCCGGCCCNANGANTNNCTTATTATATGTNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14940F5HMR1
Sequence
TAAGGACCGTTAGCATTTCTGTGGCTCACAGCTGCTGCAGATGTGCGACATGAAGTCATTTTATACTTGGGAGGTGAGGT
TTCTAGACAGGTCCGATGATAGACTTGTATTAATACAAAGATGTGTGTCCGAGCCGTAGGTTGGATTAAGATCATTACAA
GCTACTTGGAGCTGTTGTTAGATACAGTGCAGGCTATTTTATTTAANGGGGACAGGTTTATTTATTTATTTAGGTTCCTC
AAGGCAGGATTTCTTTGTGTTTCTTTGGCTATCCTGGAACTCACTCTGTACACCANGCTGGCCTCAAACTCNTANAGATC
TACNCATGGGGTAAAGAGGC
Sequence Type genomic DNA
Unitrap ID UNI20391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66858675..66859013 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023460 (Rab12) NP_077768 RAB12, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab12-001]

 
Come back to gene ENSMUSG00000023460


For any suggestions or comments, please send an email to unitrap@crg.es