Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14708C9
Clone ID IST14708C9
Vector VICTR76
Project tigm

Sequence tag IST14708C9HMR1
Sequence
AACTAGATTCTGTCCTAGGACTCAGCCAGTTCAAAACCCCCTCATCCCCTCATTTAAACAATTGTTTTACTTCGGCAGTG
CTGTGAATGGAATCCAGGACCTCATACAAGCTAGGCCAGTGCCCTGCCATTCAGCCACACCACCAGCTGCTTGGGGGATG
GCTGCTTACTCTTTCCAAAGGCTTGTGTCCTTGTACACAATATTGCCACAATAACTTTCTAANCACCTACTCCCACCGCC
TTTTCTTANGGATGTAGCTCTCTACTTTTTGATAGCTAGTCAATGACAAGAGCATCAGAAAACCAAACTGACTCTGTCTC
CTGATAAGTN
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73023743..73024071 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]


Sequence tag IST14708C9HMF1
Sequence
GTTTAAGCCACTGAAATGAACCCAGCTTTCTTGTCTGGGCTAATAGTATCACATTCCTGCAGATGACACATTAGAGGCTG
TACAGAAAGTGTGTTAACGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73023647..73023745 99
NO GENE  


Sequence tag IST14708C9BBF1
Sequence
GTTTAAGCCNCTGAAATGAACCCAGCTTTCTTGTCTGGGCTAATAGTATCACATTCCTGCAGATGACACATTAGAGGCTG
TACAGAAAGTGTGTTAACGAGCTCTTGACAGCAAAACAGAAATAGTTTCTTTTCTATTCCACAAAAACCGGGCTTTATCA
TGAGGAATATAAATTGAGGGTTTTGTTTAACTTTTAAAACTCAGCAGCATAAGACAGAGATGTGTGTGAGACCAAGCCCA
GTGTCAGCTAAGAATGGATTTATTTTTCTGTCAAAAGCTGTTCTCAGACAGACACACCTAAATAAACTCCAACTGAGACT
CAGGCAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73023414..73023745 330
NO GENE  

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es