Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14869H2
Clone ID IST14869H2
Vector VICTR76
Project tigm

Sequence tag IST14869H2HMR1
Sequence
AAGTAATACTGAAGTGTGAATTCCAAAAGAGCTGGTGCCTTGTATGTGCCATTAATATAATCNCATGAAGGAATATTACA
CCTTTANATCTTTGAATTTTTTTTTTTTCCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI22080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107123803..107123923 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]


Sequence tag IST14869H2BBF1
Sequence
ACTTGAAATACAATGCATGATGCAAACACAATATAAAGTACTTAAAACTTTTTACAGCCATATTTTCAACAGCAACATAC
AAACTGCATTAGTACCAGTCAAGCACTCAGGTTTCACCAGTTTAAAGGTCTACACTGAATTATAACTTCAATATAGAATC
TCCATTTCTTTCTTACCAAACCTACTGGAAATAAGGTACAGCTGTATAGCTGACACCTAGTTCCCTAGATACTTACACAT
GGCCCTGAAGCAGGTTTTCTTGATCTGGGGAACTTTAGTTGTTTAGGTTCTGAAACACTTTCCTTCGTGGGGCCNAAATT
AACTAANCTACAACACGATTAAGGCAAATCCNACACATCTCCCAGATGCANTAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107123920..107124294 367
 
EST/CDNA Est Name
  BY320658.1 - CD552031.1 - BY207584.1 - CA873134.1 - BY219207.1 - CV558785.1 - CA327487.1


Sequence tag IST14869H2HMF1
Sequence
ACTTGAAATACAATGCATGATGCAAACACAATATAAAGTACTTAAAACTTTTTACAGCCATATTTTCAACAGCAACATAC
AAACTGCATTAGTACCAGTCAAGCACTCAGGTTTCACCAGTTTAAAGGTCTACACTGAATTATAACTTCAATATAGAATC
TCCATTTCTTTCTTACCAAACCTACTGGAAATAAGGTACAGCTGTATAGCTGACACCTAGTTCCCTAGATACTTACACAT
GGCCCTGAAGCAGGTTTTCTTGATCTGGGGAACTTTANTTGTTTAGGTTCTGAAACACTTTCCTTCGTGGGGCCAAAATT
AANTAANCTACAACACGATTNANGCNAATCCNACACATCTCCNANANGCNNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107123920..107124288 349
 
EST/CDNA Est Name
  BY320658.1 - CD552031.1 - BY207584.1 - CA873134.1 - BY219207.1 - CA327487.1

 
Come back to gene BY320658.1 - CD552031.1 - BY207584.1 - CA873134.1 - BY219207.1 - CA327487.1


For any suggestions or comments, please send an email to unitrap@crg.es