Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14576F3
Clone ID IST14576F3
Vector VICTR74
Project tigm

Sequence tag IST14576F3BBF2
Sequence
ATATGAACAAGGGAGATATAGAGAAAGAAGAAACAGGACTGAATAAACGTGTGCAGAAGGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32314 UNI32315 UNI32316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 47371803..47371865 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5261629..5261691 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42983584..42983646 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072609 (AC138113.3-202)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 17188366..17188428 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028780 (Sema3c) NM_013657 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:MGI Symbol;Acc:MGI:107557]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 25598574..25598636 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108738615..108738677 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12834574..12834636 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 99675563..99675625 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026333 (Gin1) NM_026250 gross passage A viral integration region 1 Complex/Cluster/Region [Source:MGI (curated);Acc:Gin1-002]


Sequence tag IST14576F3HMR1
Sequence
NGTGAGCNAGCTACTCCTTCACAGTCATTTCCCCTGTTGTCTGTAGGGACGGACGGCTTTGCCCCGTCTTTANAAATGTT
ACATTTCGCATCTATTTTNATGTCCGTTACTGGAAGAGAGCAATTGTGCGTGTGTGTGCATTGCTGANCGAATCTGAGTT
TTGAAGTTCTGCTGAAGGCTTCTGAAGTTCCATACAAGCAGAGTTACCTGGGCTGCTTCTGCCTTCTCTGTGTTCCCTTT
GTTCCTGTCCCTCGCTCTCCTGTCTTTNCCTCCCACAAGGCAGGGAGANGCCTGANTGGGCNCTANCTCANNTTTNANAG
CCTTTCNGTCNTCNGTCTGTCCCCATAACATCNANGTCATGGNATTAACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14576F3HMF3
Sequence
ACATCTGCTTGGAGTCAGGTTCCTGCCCTTGCTCCTAGACTGTAAGACTTAAGGGGTCATTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73584563..73584629 67
NO GENE  

 
Come back to gene ENSMUSG00000026333


For any suggestions or comments, please send an email to unitrap@crg.es