Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14406F2
Clone ID IST14406F2
Vector VICTR74
Project tigm

Sequence tag IST14406F2HMR1
Sequence
AAGTAAACTCCTTCTCGGTCAGTTGGTCATTTTATTCCACAGTGTTTTTCACAGCAGTGGGAAGCAAATTAGTTCATCAA
GTTTTTCATTTGATTTTCATTTCACTTCGGTGGCTTAAAAGTTATTAGAATGTTGGTCTGGTGAGATGGCTCANCAGGCT
AN
Sequence Type genomic DNA
Unitrap ID UNI10483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75252487..75252647 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042688 (Mapk6) NP_081694 mitogen-activated protein kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1354946]


Sequence tag IST14406F2HMF1
Sequence
ACTTCACCTACTACTCACAGTTTATCATAAAGGGAAGTCAGGGCATAAACTCAAAGCTGGATCCTGGAGGCAGGAACTCA
AACAGAAGCCATGGAGAAACCCTGTTTATTGGCTTGCTGAGCCTGCTTTCTTTCTTGTTTGTTCCGGGAGTGGTTTTGTT
TGAAAACAGGCCTTCACTGTGCAACCCAGGCTGGCCTGAAACTCAGATATCTGCCTGGGACCTTCCACACCAATTAATCA
AGAAAATGCCCTACAGACTTAACTACAAGACAATCTGATGGAGGCATTATCTCAACTGAGGTCTCTCTTCGCAGATGACT
CTAGTTTATGTCAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75252644..75252980 337
 
EST/CDNA Est Name
  CN670785.1 - CD543610.1 - CD555493.1 - CA883972.1 - CD549697.1 - CF165323.1 - CA542002.1 - CD554138.1 - BE553422.1 - CD538553.1 - BM935972.1 - CD552379.1 - CA880218.1 - CN696993.1 - CN692375.1 - AA184053.1


Sequence tag IST14406F2BBF1
Sequence
ACTTCACCTACTACTCACAGTTTATCATAAAGGGAAGTCAGGGCATAAACTCAAAGCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75252644..75252706 63
NO GENE  

 
Come back to gene CN670785.1 - CD543610.1 - CD555493.1 - CA883972.1 - CD549697.1 - CF165323.1 - CA542002.1 - CD554138.1 - BE553422.1 - CD538553.1 - BM935972.1 - CD552379.1 - CA880218.1 - CN696993.1 - CN692375.1 - AA184053.1


For any suggestions or comments, please send an email to unitrap@crg.es