Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14563B5
Clone ID IST14563B5
Vector VICTR74
Project tigm

Sequence tag IST14563B5HMF2
Sequence
ACATTACACTGAAAATACTCTCTCATCCTGTGATTCAGAATATGTTTTTAACATTAAATAAATTTGACAGANNNGNATGC
TCACAGTCATCTATTGGATGGAACACAGGGCCCCCAATGGAGGAGCTAGAGAAAGTACCTAAGGAGCTGAAGGGGTCTGC
AACCCTATAGGTGGAACAACAATATGAACTAACCAGTACCCCCAGAGCTCATTTCTCTAGCTGCATATGTAGCAGAAGAT
GTCCTAATTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI13416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78792852..78793105 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]


Sequence tag IST14563B5BBF1
Sequence
GTTTTTCTATGTGCTTTGTCTTTAAAAACTCCCTGTAATGTGCATTTGAGCCTGCTCTTGCTCTAAAAAAACGATTTTTC
TCCAGGTAGTCACCTATCTTAATATTAGATTCATACTCTCTCCCCTCCCCTCCCCACCCCACACCCATTGACTTTTCGAG
ACAGGGTTTCTCTGTGTAGCCCTGATTGTCCTANAACTCACTCTTTANACCAGGCCGGCCTCGAATTTAGAAATTCGCCT
GTACCTGCCTCTGCCTCCCAAGCGCTGGGATTAAAGGTGTGCACCACCACTGCCCAGCTTANATTCTGAATTCAGACTTT
GGTCTCTACCTCACAATAAAGCCTGCCCCTGGGACCCACATGATGAGAAAGTACTCTCTACAAGGTTCTCTTCTGACCCC
TGTGTGTGAGACTACATACATACTAAAACAAATTATGTAGTTNATTTATTATTCTTTTCTTTTTTCTTTCTTGAGACNNG
ATTTCTTCNTGCANTTNTGGANCTNAATATGTNNATCANTCNGGCCTCANACTCNCNNANATGTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87227479..87228022 504
NO GENE  

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es