Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14465D8
Clone ID IST14465D8
Vector VICTR74
Project tigm

Sequence tag IST14465D8BBF1
Sequence
ACTATAAAACTGCACCTTGACTCAGGAACACTTTATCAACTATAAGAGCCACAGAAAGAAATTAGTTACAATTTTATGAG
AAATGTGCTTAGTCATATGAACTTTGTAANACACAAAGGAAGAAAATATTTTACCANTCTATTGTTCANTGGCCTAATGA
CAATGTATTCTTGATCATGTTCAACCAGTCAGTCTTCCGCATCTCTTCCTTAGGGTTATGCTAATTTNAACTATTTCTAA
TCCCTACCTCAAATTANCCCAAACCCTGAGCCNCCCANTACTTCCAGGATNATTAAAAGGATCTGTTCCATCTAATTTTC
AGTANANAGCTGTAAAAANAACANTATAAAACNANGCNTTATCATTTCNCAGGNNGNANANTCNTCTCCNGGTCTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14465D8HMR1
Sequence
TNGTAATTCNCAGTAAATATTTTTTTAAAGATTTCCTTATTTATTTATTTATAGAGTGTGTCTCTCTGTGTGTGTGTGTG
TGTGTGTGTGTCTGTGTGTGTNTGTGTGTGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32918303..32918414 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]


Sequence tag IST14465D8HMF1
Sequence
ACTATAAAACTGCACCTTGACTCAGGAACACTTTATCAACTATAAGAGCCACAGAAAGAAATTAGTTACAATTTTATGAG
AAATGTGCTTAGTCATATGAACTTTGTAAGACACAAAGGAAGAAAATATTTTACCAGTCTATTGTTCAGTGGCCTAATGA
CAATGTATTCTTGATCATGTTCAACCAGTCAGTCTTCCGCATCTCTTCCTTAGGGTTATGCTAATTTGAACTATTTCTAA
TCCCTACCTCAAATTAGCCCAAACCCTGAGCCACCCAGTACTTCCAGGATTATTAAAAGGATCTGTTCCATCTAATTTTC
AGTAGATAGCTGTAAAAAGAACAGTATAAAACGATGCATTATCATTTCACAGGCAGCAAAATCGTCTCCTGGTCTCTTCC
AGTCTGGTTTGCCATACATAGCTGACACTGTGTTTGCATTTCNNNNTTTTACTTTTGAGACNAGGTAATACTGGCCCTTG
AACTCCCAATCCCCCCATCCCACCTCCTCNNACTGACTACCATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32917781..32918304 507
NO GENE  

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es