Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10948B1
Clone ID IST10948B1
Vector VICTR76
Project tigm

Sequence tag IST10948B1HMR1
Sequence
ATACCAACTTTAAGGCAACTGTTTTAGTAGAAATATTGGACATAAAAGCCAGAGGAGGGAACAACCTAAAGAACAAGCGC
CCTGATATTTGAACTTAGTCTGTTCTTGTTTGTAAAGTAAACCCCACAGTAGACTTACTGATTCCTGGAAGGACTCCTTT
GTTGTNCTTTGGGATATCGCCACCACAGGCCGAATTGCCCTCCGGTGTGTGANNACGGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30063628..30063849 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


Sequence tag IST10948B1HMF1
Sequence
GTATCACTTCCCTAGCAAGCTGAGCGTCCTGAGATTCTACGGCCTANAATGCGTAAACCCTAACCACAAATCTAAGGTTN
AAATAAAGACGTTACAAAAAAACCAAAGTGGCTGCACTGGGCAGGCACTCCCCACCTTANAAGGTGGGACCATCCCCACC
ATTCCCTTTCAACGGTTCACATACAACTTCTTCGGTAACAAAGCTTTTAAAACTTGNNNNANCCNTCCTGTTTAAAAAAA
AAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30063386..30063631 228
 
EST/CDNA Est Name
  BX633822.1

 
Come back to gene BX633822.1


For any suggestions or comments, please send an email to unitrap@crg.es