Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12075D8
Clone ID IST12075D8
Vector VICTR76
Project tigm

Sequence tag IST12075D8BBF1
Sequence
AAGTTACATTAGCCNTACCTAGAGGCAAAATTTTCTAGTGATTACAGTTCACTAGAAGCAAAACTCTTTGAATTTAAGCA
TTATTTTAAACATCTGAATAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI30811 UNI31035 UNI31094 UNI32321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 27090..27196 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 255478..255584 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 168285..168391 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54250887..54250993 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31382022..31382128 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45816762..45816868 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19013904..19014010 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23579869..23579975 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222105..5222211 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 129011662..129011768 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14346130..14346236 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89636089..89636195 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124033590..124033696 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3328696..3328802 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 149298146..149298252 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11612710..11612816 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es