Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10373D9
Clone ID IST10373D9
Vector VICTR76
Project tigm

Sequence tag IST10373D9HMF2
Sequence
CTCTCACTGCTGAGCCATCTTTCTAGCTCCAACAACTGAATTCTNATTTTTGTCATTTATTCACTTATTTGTTTTTTGTT
TGAGTCTGGATCTTACCTGTACCCTACACTGACCTTGGGCTTGCTATTTAAACACAGGTTGGTCCAAACTTGTCGCAGTC
TGTCTGCATCAGTCTTTCTGAGTGTTGCGATTACAGCATGAGTTGCTATGTCCAGGACAGCCANNGCAACAAGGGAGTTT
TGTTGTCNNAAAAACAACAAAAATAAAACAAAACAATTAAAATATATACATATTCTGGTTATCTATTNAAAATTCATCAC
AATTTTAAATAAAGAAATATGTATGTGTGTGTATATGTATATATTATATAATTGTATATATGCACACACATACACATATA
TATCTATATATGTATATATATAGGTATATATACATATACACACATTTGAATNAAAATTATNAATGAACCTATTTTNAAAA
ATGTACCATTTCAAATGGATAACATTTTATNATCTTTANNNTTTAAATNTGTCN
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71190061..71190592 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST10373D9BBF1
Sequence
ACGGGAGTCAGTATCCAGCTTTGCTCTATTTCTCTTTATCATATTGTTTCCCTGAATCTTTTTACAGCACAGTACTGAAA
AATTATCATTGAACTGTATCTGCCACAGAGCCTAGCTTCTCANAAAAGCCCCACCAAAGCTATGCTTCCATTCTTGTTGC
CACAGTGTTCGAGGCCAGCTGCTCAGTGACCCACCATGGTATANCTACCACGACGGGTGTTGAANAACACACTGTCTCTT
TTCTTTATAGTTAGAACCTTGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI35287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59374760..59375026 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026023 (Pftk2) PFTAIRE protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:3583944]

 
Come back to gene ENSMUSG00000026023


For any suggestions or comments, please send an email to unitrap@crg.es