Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0129
Clone ID DD0129
Vector pGT1lxrT2
Project sanger

Sequence tag DD0129
Sequence
ATGTCCGAGCCTGTGGAGCGATTAAACCGTGCGCGGAGCTGCTTCTTCGGCGGCAGCGGCGACCAGCAGCAGCCGGTGCG
GGCGCGCGGAGCCGGCCGGGGACGCCAGGTGGCCGGAGCGGTGGAGCGGCGGCGGAGCGGGCGCCGCGGGGGGTGTGGCG
CGAAG
Sequence Type mRNA
Unitrap ID UNI1642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108160457..108160620 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es