Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10919B3
Clone ID IST10919B3
Vector VICTR76
Project tigm

Sequence tag IST10919B3HMF1
Sequence
GTTGGAGCCATCGGTAATCAGCCTGACCTTTTGGTGCTGTGTTCTTCCTCTCCCACTCTCTCCAGGCCTCCCTGACTTAG
TCCCGGACCCTAACTACGTGCAGGCATCCACATACGTGCAGAGAGCCCATCTGTACTCCTTGCGATGCGCAGCAGAGGAG
AAGTGCCTGGA

Sequence Type genomic DNA
Unitrap ID UNI32324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58145432..58145601 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es