Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568F6
Clone ID IST14568F6
Vector VICTR74
Project tigm

Sequence tag IST14568F6HMR1
Sequence
ATACCACCACAGGTAGCGGTTGGTTTTTGTTTGCTTGTTTTTAACTAAGGATTTGGGAATTGAACTGAGGTCCTTGTAAA
GTGCTTTACTGACTGAGCCAGCCCCTACCCAGTGTAATATTGTTCATGTATTTTTTTCATTTGTAAGTGTGCTCTTATGT
ATATGCCACACATGTGGGCACACCTANTTATTTCAGGAATTTTTCCTAATATGGTAATATATCANCTTTGTAATTTTACA
TTANTATAAATCTCTAACTTGCCTCTGTCTANTTTTGTCANTATTATTATCTATTGCACCTTCTTCCCTGTGACACAACA
CGAANGGAANTATGTTGTGTTGAGTTGTCNTGTCNCTTTTGCTTCCTTTNNGANTATTGGTGTTNNGCCNTGTTTN
Sequence Type genomic DNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152074536..152074930 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]


Sequence tag IST14568F6HMF1
Sequence
TTATATGACTAATTATCGCGCTGGGGAGATACAGTCAAGATTTCTGAGGATCTGCTAGCCAGCCACTTCAGTCCTAAATT
GGTGAGCACCAGGCCAATCAAGACCCTGTTTCAAATAAGAGGTGAATGTATTCAGAGAGCACAGTTACTTATTCTTTGGC
CAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152074378..152074538 161
NO GENE  


Sequence tag IST14568F6BBF1
Sequence
TTATATGACTAATTATCGCGCTGGGGAGATACAGTCAAGATTTCTGAGGATCTGCTAGCCAGCCACTTCAGTCCTAAATT
GGTGAGCACCAGGCCAATCAAGACCCTGTTTCAAATAAGAGGTGAATGTATTCAGAGAGCACAGTTACTTATTCTTTGGC
CACCATAATAACTGCACATACAGGTACACTCTCAAATAAGTGCACTGGTGCATACACAGACAGACATAAGCTAAGCTAAG
AACATCGCACACCATACACCCACACACAAGCAGTTAAAGGGTGGAGAGATGGCTCAGTGGCTAAGAGCACTGACTACTCT
TCCTGAGGTCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGG
TGTGTCTGAAGACAGTTACAGTGTACTCACATAAATAAAATAAATCTTTTTTTTTAAAAGCAGTTNGAANNTAACTGTNN
NNTGGTGGCACATGCCTTTTANTCACAGCACTTGGGAGGCAAAAACNTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152074006..152074538 506
NO GENE  

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es