Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15045H8
Clone ID IST15045H8
Vector VICTR78
Project tigm

Sequence tag IST15045H8BBF1
Sequence
CTTCTAGCATATTAAGATTTTATTCCTGGTGCCAGGCGGTGGTGGTGCACACCTTTAATCCTAGCACTTGGGAGTCAGAG
GCAGGCGGATTTCTTAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGTCANGGCTACNCANANAAACCCT
GTCNCN
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71201134..71201296 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST15045H8HMF1
Sequence
CTTCTAGCATANNNNNATTTTATTCCTGGTGCCAGGCGGTGGTGGTGCNCACCNNNNNTCCTANCACTTGGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es