Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0084
Clone ID DD0084
Vector pGT1lxrT2
Project sanger

Sequence tag DD0084
Sequence
GAGAAGATTTTTCCATCGTCGCTTCAGACACTTGATTGAGTGAAGGATTTTCAATTCATACCCGAGATAGCCCCAAATGC
TACAAACTGACAGACAAGACAGTAATTGGCTGCAGTGGTTTCCATGGAGATTGTCTCACTTTGACAAAGATTATTGAAGC
AAGATTAAAGATGTACAAGCATTCCAATAACAAGGCCATGACAACGGGGGCGATTGCTGCAATGCTGTCTACCATCCTGT
ACTCACGGCGCTTCTTCCCTTACTATGTTTACAACATCATTGGAGGACTTGATGAAGAAG
Sequence Type mRNA
Unitrap ID UNI1644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15627120..15631467 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014769 (Psmb1) NM_011185 proteasome (prosome, macropain) subunit, beta type 1 Gene [Source:MGI Symbol;Acc:MGI:104884]

 
Come back to gene ENSMUSG00000014769


For any suggestions or comments, please send an email to unitrap@crg.es