Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P081D09
Clone ID P081D09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P081D09
Sequence
CCAGAGACGGCCGCATCTTCTTGTGCAGTGCCAGCCTCGTCCCGTAGACAAAATGGTGAAGGTCGGTGTGAACGG
Sequence Type mRNA
Unitrap ID UNI6920 UNI6921 UNI6922 UNI6923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166349: 396370..396444 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078142 (AC147142.2-201) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12504592..12504666 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078300 (AC150660.4) Glyceraldehyde-3-phosphate-dehydrogenase Fragment [Source:UniProtKB/TrEMBL;Acc:Q6IWE3]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20235994..20236068 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078965 (OTTMUSG00000005300) NP_032110 predicted gene, OTTMUSG00000005300 Pseudogene [Source:MGI Symbol;Acc:MGI:3650751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51430797..51430871 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078308 (CT030181.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12114425..12114499 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079360 (AC158396.2-202) GAPDH Fragment [Source:UniProtKB/TrEMBL;Acc:Q2VWQ4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 33529282..33529356 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071343 (AC107864.11)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60029047..60029121 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070025 (AC130841.4) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TUZ9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83825352..83825426 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079501 (AC156283.6) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 59002015..59002089 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078088 (AC163335.6) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 13043412..13043486 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073212 (OTTMUSG00000017911) predicted gene, OTTMUSG00000017911 Pseudogene [Source:MGI Symbol;Acc:MGI:3709612]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57384804..57384878 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078696 (AL772328.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142625523..142625597 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078162 (AC102196.7) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77440169..77440243 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081221 (AL808132.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28790107..28790181 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083773 (AL732526.8)  

 
Come back to gene ENSMUSG00000083773


For any suggestions or comments, please send an email to unitrap@crg.es