Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10458A6
Clone ID IST10458A6
Vector VICTR76
Project tigm

Sequence tag IST10458A6BBF1
Sequence
ATTCTAAACGTGACTATTANTACTGAGTGGGAAGATATAGTANGCACCGGGCCAAGTGGATGTTCATTATGTCATCCAAT
CCTTACAACAATTCACAAAGTAAGCACTGTTGTTACTATATCTGCGTGTGAGTGCCTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI13451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34303076..34303252 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037636 (Slc25a43) NM_001085497 solute carrier family 25, member 43 Gene [Source:MGI (curated);Acc:Slc25a43-001]


Sequence tag IST10458A6HMR1
Sequence
NTTTNGCTTATACTTNNNANNATTGGANGAAGTCANGACANGAACTNNNATANTTTCNNCCTCANACTCNNNAACCTGGT
GGCAGGAGCTAAANCANAGGCCATGGAGGAGGGCTGCTTATTGGCTTGTTCCTTATGGCTTGCTCANTCTACTTTCTTAT
ANAACCCAGGACCTCCAGCCTAGGGATGGCACCACCCACAATGGGCTGGCCCTGGANGAAAATCACTAATTGAGAAAATG
ATTTATAGATGGTTCTCATGGANACNTTTTCTCAACTGAGGTTCCTTCCTCTCTGATAACTTGAGCTTGTGTCNAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037636


For any suggestions or comments, please send an email to unitrap@crg.es