Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14472D5
Clone ID IST14472D5
Vector VICTR74
Project tigm

Sequence tag IST14472D5HMR1
Sequence
TTCCCATCAGGGTTCTGTTTTCACCAAAANAAAAAATATATCTGAAAAAAAATTGTTTTTGTAGGAAATTCAAAGAAAAC
TAGGTCTGATCTAGATATTGGTATATATGATGATTTTTCTCCAGTTTTCTAGTCTATGAAGATGTAATTTATTGTACATT
AAAAGATCTGTAAGACACAAGTTGGAAAATTGATCATAATTTAGTTATTTGGGATATTTGTTATGTGATAATGAACAATT
ANCANATGGAAAAAAAAGGAAATTTGTNNNNNNNNNNNNNATATGTGNNNNNNNTTTCCTAATGAANGNNNCN
Sequence Type genomic DNA
Unitrap ID UNI22384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21020506..21020772 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020134 (Peli1) NM_023324 pellino 1 Gene [Source:MGI (curated);Acc:Peli1-001]


Sequence tag IST14472D5HMF1
Sequence
GGAAACAATTATTGTTACTTTTTGGTGGAAAGCTTCCCTGTGGTTAAAAATCGATTANATATAACACTATTCAATCTCTT
TACCATAATCGCAAATTAGGATATTGAGATAGAAGCACTACTTAAATTGCTGTAAAGCANAGCTGACCNATGCACAATGC
TCTATCTACTAAATAAACTTCTTCAGAGAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21020319..21020509 185
NO GENE  

 
Come back to gene ENSMUSG00000020134


For any suggestions or comments, please send an email to unitrap@crg.es