Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10765C6
Clone ID IST10765C6
Vector VICTR76
Project tigm

Sequence tag IST10765C6HMR1
Sequence
GTTGATGACTCCTGACCCACAGAGCCTGCAGGGATAGCACAAACTTTATTTGGGGAAACTTANAATCTTTTTTTTAAACG
GGTATGGAAACTGACTATGGTGGGACTGAAGAGTATGAATTACTGTCCTCTTTCTGTGAGATGTTGCTCTGGCTTCCCTG
GGTCCCAGGCAGGGCTCTTTGTCCACACCTCCTTGGTGAANACACCGCTGGGTCCTGGGACCAGCGTGCTTGCCATCCCA
GGGCAGGGGTGTCTCCTCAGCACANTCCCCTTCACNANAGGATTCTGGTTGTGTCATN
Sequence Type genomic DNA
Unitrap ID UNI20007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97653238..97653534 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031788 (Kifc3) NP_034761 kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]


Sequence tag IST10765C6BBF1
Sequence
GTGAGCAGCCTGTTCACAACAAGCCTCAATGCAGCCCATCCTGCCTTCACACAACAGTCTTAGGGCAACACCCCTGCAGT
GTCATCTGCCGTAACACCTTGGCAGACAGCTCCCCACCTGAGGATGGCACTCCCAGGACTAGGAGGGTACACATTGAGTC
TATCTGACCAGGACAATGACCATGATGCCTCCTTTGTGCTGTGTCCTACGGGGCTATCCAGGGGCAATGCAACCCCATGT
TCTGGTCAAGGAACTAAGGCAAAGGTGCCTGGGCTGAAGCAGGTGAGTGGAGGGGTGGGAAGGGGCGCTTCATTCGGANA
CTTCCCGGGAGCTCACGGAGAAAGGCACCAAGCAAGGGAGACAGTATGGGAAAGTGCGAACCCATTTNAGGGTAATGCTA
CATAAGACACAGGAGAAACGAGCCGGAAAGCCCACAGGCAGCGGGGTCTGTGTGTGCTCGGTGTTGGGGTGTGCACACAC
AGANNNCCACTGACNTGGAAACAAGTGCACTTTANNNNTGGGNAATGGAAATAAACTTCNNNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97653537..97654075 517
 
EST/CDNA Est Name
  CF915212.1 - BY735370.1 - DN176411.1 - BY740310.1 - CJ077929.1 - BI557324.1 - BI558906.1 - BY769709.1 - BQ109292.1

 
Come back to gene CF915212.1 - BY735370.1 - DN176411.1 - BY740310.1 - CJ077929.1 - BI557324.1 - BI558906.1 - BY769709.1 - BQ109292.1


For any suggestions or comments, please send an email to unitrap@crg.es