Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14923H5
Clone ID IST14923H5
Vector VICTR76
Project tigm

Sequence tag IST14923H5HMR1
Sequence
NTATGTAAGTACACTGTAGCTGTCTTCAAGTGTGCCANAAAAGGACATCNGATCNNATTACCNATGGTTGTGAACCACCA
TGTGGTTGCTGGGATTTGAACTCAGGACCTTTGGAAGAGCAGTCAGTGCTCTTAACTGCTGAGCCACCAGCCCTACTCCC
ATCCTTTAGCTTGGCTTCACTGGGGTTTATATCTTTTTGTGATATTATGAAGATAACAGCTCTTGACAGCAGGACCCTTT
TTTANATTTAATGACTCCTGTTTTTTGTCTCTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4994737..4995025 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


Sequence tag IST14923H5HMF1
Sequence
ATATAATAAATAAGTCTTTAAAAAAAACAAAAAACAAAAAACCCAACAAGGACAGGAGTATATAAGTGGTCGGTCTATGT
GCTCATTCTCCTGACTATACCGGATGTGTGGATACCCTGGTTCCAACTTCAGCATAATGTACACAAAACTGACCAGGTTA
ATACAATTCCAAAAACTGTCAAANANAAAACAGCACTTAATAGGCCTACAGGAAAAATTGCTCTAGGTTCACAATTGCCA
TTTCTTAAAACCTAAAAATTATTTCAACATCANCAACAACAAAAATCACAAATTTTCTTCTCTGTAACTAANTCTACCTA
TAATTTTCCTTCTCATATGAAACCTATATTATATCAAAAGGAACCNNCCNTGTGANGTGTCANACCCCTTTCATCCCTGC
NCTCAAGCNNANCTNANGTGGATCTCTATGANTTTGANGTCNNCCNANTCTACANANTGNNTTCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14923H5BBF1
Sequence
ATATAANAAATAANTCTTTAANAAAAACAAANAACANAANACCCAACANGGACAGGAGTATATAAGTGGTCGGTCTATGT
GCTCATTCTCCTGACTATACCGGATGTGTGGATACCCTGGTTCCAACTTCAGCATAATGTACACAAAACTGACCAGGTTA
ATACAATTCCNAAAACTGTNNAANAGAAAACAGCACTTAATAGGCCTACNGGAAAAATTGCTCTAGGTTCACAATTGCCN
TTTCTTANANCCTAAANNTTNNTTCAACATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es