Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14816G9
Clone ID IST14816G9
Vector VICTR76
Project tigm

Sequence tag IST14816G9HMF1
Sequence
NCGGTGTCCCCTTAGGTGTTGCCATGGAAAGAAATCAAGCCTCTTTTGTTGTTAGGGCTTCGCTGAGTCTCAAAGCTAGA
GAGTGCAGTGGTTCTCAACCTTCCTGATGCTTCACCCCTTTAACACAGTGAGTGCCTCATGTTGTGGAGAACCCTAATCG
CGAAATTGTTACTCCACAACCATAATTTCGCTGCTGTTATGAGCTGTAATGTAAATATCTGATGTGCGGGCTCTCTGATA
TTGCACCACTGCTATAGAGGATCAGAACCCATGCATGACTACCAACCAGTGACTGGCTGTGGCTGACCTTCTCTGGTACA
AACTGGCTTTGGGAAATACTGGGGATGGCTCCCCTTCTAGCCNGTGAGCAGTTTGTCACATACAACCTACTTTTTTTTTT
TTTTNNTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30919828..30920237 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14816G9BBF1
Sequence
GCGGTGTCCCCTTAGGTGTTGCCATGGAAAGAAATCAAGCCTCTTTTGTTGTTAGGGCTTCGCTGAGTCTCAAAGCTAGA
GAGTGCAGTGGTTCTCAACCTTCCTGATGCTTCACCCCTTTAACACAGTGAGTGCCTCATGTTGTGGAGAACCCTAATCG
CGAAATTGTTACTCCACAACCATAATTTCGCTGCTGTTATGAGCTGTAATGTAAATATCTGATGTGCGGGCTCTCTGATA
TTGCACCACTGCTATAGAGGATCANAACCCATGCATGACTACCAACCAGTGACTGGCTGTGGCTGACCTTCTCTGGTACA
AACTGGCTTTGGGAAATACTGGGGATGGCTCCCCTTCTAGCCNGTGAGCAGTTTGTCACATACN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30919856..30920238 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14816G9HMR1
Sequence
CCNNANANCNCNANCNNANNNAANNNNNNGNNNNTGGGCGANNAATTCTTCTCACCTCTCACCAATTGACTAACACTCCT
TCAAGGATCTCAACAACTCACTGCAGGAAAACAAGCACTTCCACAAAAGTGCAGAAACTTCTCTCTGANAGTTTCCAGAA
TCCCAAACCATGGGGTAAGGGCTGGCAAGATGGCTCGGTGGGTAAAGGCGCCTGTTGCTAANCCTGATGCCTGAGGTCCA
TTCCANGGTCTNACATAAAGAAAGGAGANAACCNANNNTACTTGTCNTCATGAACACACACNCACACACACACACACACA
CACACACACACACACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es