Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15105E8
Clone ID IST15105E8
Vector VICTR80
Project tigm

Sequence tag IST15105E8BBF2
Sequence
CATTGAGGGTGGAGGGGCGGCATCACTTAGGTGCGGCGTGTGTTTGGTGATGGATAGCCAGGTTTTTTTGTTTTGTTTTG
TTTGAGTGTCTTGTTTCTGATAGGAGCTAATCTCTCATCGTAACCAGGAATAAGGTGGGAATTGGCGCCTGCATTGCTGT
AGGGAGACTTACAGCAAGCCCTTGCTGGGCTTTGAGAACCTTTCTCCCTGTGAGATGCCTAAGCGGGTGGTCAAGAATCT
CAGTTCTTACCCTGTGGCAGAGAAAAAGGAACGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165636725..165637002 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST15105E8HMR1
Sequence
NGNGNNNNNNGACNGGGCNNANCCTGNNNANTCTGGCTTCCAAGGANACTTGGGTTTCNTCCCNGGANGANCCCCANACT
CTGCTGCTCTGGAAATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15105E8HMF1
Sequence
CATTGAGGGTGGAGGGGCGGCATCACTTAGGTGCGGCGTGTGTTTGGTGATGGATAGCCAGGTTTTTTTGTTTTGTTTTG
TTTGAGTGTCTTGTTTCTGATAGGAGCTAATCTCTCATCGTAACCAGGAATAAGGTGGGAATTGGCGCCTGCATTGCTGT
AGGGAGACTTACAGCAAGCCCTTGCTGGGCTTTGAGAACCTTTCTCCCTGTGAGATGCCTAAGCGGGTGGTCAAGAATCT
CAGTTCTTACCCTGTGGCANANAAAAAGGAACGGGATCCCTGTGGTGCTGTGGTGNNNNNGGGGGTAN
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165636696..165637002 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es