Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10048F12
Clone ID IST10048F12
Vector VICTR75
Project tigm

Sequence tag IST10048F12BBR1
Sequence
TTGGGGACCCCGGAAGAACTCTACGAAGGGCCCCTGGGCAAGTACAATGTCAATGACATGGCCAAGTCAGCGCTGAGCGA
GCTCAAGTCCTGCATCGATGAACTACAGCCTGTGCATAAGGAGCAACTGGTCAAGCTGCTGGTAATCGGGCTGGGACTCC
CATCCCCGAATGTTTGCAGTTCTTCCGAGACCCTCCTGGTGCTGGATCACCAGTCCTCCCCGATCCCCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI32337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148032007..148032238 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038801 (Scgb1c1) NM_001099742 secretoglobin, family 1C, member 1 Gene [Source:MGI Symbol;Acc:MGI:2655401]

 
Come back to gene ENSMUSG00000038801


For any suggestions or comments, please send an email to unitrap@crg.es