Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12718G6
Clone ID IST12718G6
Vector VICTR76
Project tigm

Sequence tag IST12718G6HMF1
Sequence
AAACAACACAACAAAAGTCTGGGTGGTCATAACTACACAGGTTCATTATGTTGGCATCTTCTATTCCACTAATCTATAGG
TTAAGACCGCAGCACCTTAGTATANCTCTGGAA
Sequence Type genomic DNA
Unitrap ID UNI27314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48316609..48316720 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]


Sequence tag IST12718G6BBF1
Sequence
AAACAACACAACAAAAGTCTGGGTGGTCNTAACTACNCAGGTTCNTTNTGTTGGCNTCTTCTNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es