Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13200C3
Clone ID IST13200C3
Vector VICTR74
Project tigm

Sequence tag IST13200C3HMR1
Sequence
CGGCAAGTGCCATCGTCCCCAGCAGGCCTTGGGGAGCGTGTGCACGTGCTGGTACTGTCCTCGTGGCGCTCGGGCTCGTC
CTTCNTGGN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114414718..114414805 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST13200C3BBF1
Sequence
GCCGGGAGACCAGGAAGACCAGGATGCCAGTCTGTACCATCAGGAGCGAAAGCATGACAGTGCTGGAGAAACGGGGTAGC
CGCATACCTCTGGCTAGGGCCTNNNNAAAAGGNGGGGTNAGGTNNNCTGTGGCCTGNNCNTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13200C3HMF1
Sequence
NCGGGNNNACCANGNNGACNNNGNNGCCCNTCTGTNCCATCNNGANCGAANNCNTGACNGTGCTGGANAAACGGGGTANC
CNCNTACNTNTGGCTAGGGCCTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es