Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P093D02
Clone ID P093D02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P093D02
Sequence
GAANNNGGGCCGATNNAGGAANNNCCCCCTATAGGAATTCTACTTATTTAGANNCTACGCACAATTACAAAATAGGGAGT
TCTAACAAGAGGTTGGGAAATCCCCTCCGCCGCGCCCGGGCCTCTGCATTGCCCGACGGCGCAGCAGCGCGGGGGCGGCT
GCTTTCTTCGCTGGACGCTGGAGTAGAGGCCT
Sequence Type mRNA
Unitrap ID UNI943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120498135..120498226 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es