Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14773F8
Clone ID IST14773F8
Vector VICTR76
Project tigm

Sequence tag IST14773F8HMR1
Sequence
NTTCCTTCCTTNCTTCCTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTT
Sequence Type genomic DNA
Unitrap ID UNI31040 UNI31041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27093357..27093440 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 68818033..68818116 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48018547..48018630 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4428598..4428681 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3832273..3832356 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 31218322..31218405 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13907003..13907086 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13079714..13079797 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 11230299..11230382 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060579 (Fhit) NP_034340 fragile histidine triad gene Gene [Source:MGI Symbol;Acc:MGI:1277947]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 118415840..118415923 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 26299578..26299661 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4060815..4060898 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6979028..6979111 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 75673011..75673094 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 48373458..48373541 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 66358176..66358259 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 36751543..36751626 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 132999611..132999694 82
NO GENE  


Sequence tag IST14773F8HMF1
Sequence
GGCAGGCAGGCAGGCAGGCAGCCATAATTGTTTGGTTTCTTTTGGTTTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181665935..181665983 49
NO GENE  

 
Come back to gene ENSMUSG00000028399


For any suggestions or comments, please send an email to unitrap@crg.es