Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14425E6
Clone ID IST14425E6
Vector VICTR74
Project tigm

Sequence tag IST14425E6BBF1
Sequence
AGAACAGTTTGTCAGTTAACAGGGGTAGGTTCAGCTGGGCATGGCGGAGCATGCCTTTAATCCCCACACTCAGGAGACAG
ACACGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21248557..21248647 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es