Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12255G1
Clone ID IST12255G1
Vector VICTR76
Project tigm

Sequence tag IST12255G1BBF1
Sequence
NANNTTNNGNTGNNGNNNNNNTTGTTGANNTTNTNNGTTTTTNNNNNNNGNTGNNNGTTGCTTTATTTTNNNTTNNTGGT
GTTGGGTGGGTGGGGGGTGTTGTTGTGTTGGATTTTTGTTTGTTTTTGTTTGCTTTGANAAAGAACTTAAAATTGGATAG
GGAGGGGAGGGGAGAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12255G1HMF2
Sequence
GTTTAATTATAAATACATAAAGCTAAAGAAAACAAGGCAAAACTAAACTCTAGTGTCTAGGCATATACCTACAAGAGGCA
AAAGAATAAAAGAAAGAAGTGACTATCAGAATTGGAATATGTGGCAGAGGGTCATCTTTTGAGAAAAAGGAAGCAGTTAC
ATAAGATGGAAGGGAAGCAGGAAGCGTTACAGGCATATTGTTTCATTTTTTAAATGATTATTACATTCTTGAGGACACAC
GTGCCACAGAGTATCTGTGGAGGTCAGAGGACAGCTTGCAGGAATGGGTTCTCTCTTTCCACCAGGTGATCCCAGGGGTC
AGAGTCATCAGGCAGTGACTTGAGTACTCTCCACCTCAGTGTTGTTTCTTGTTAATTATAGGCGTATGTCTGAGTTTATA
TATGAACATGTACATGCAGGGACACAGANGCCAGANGTGTTGGATCATCTGGAGCTGGAGTTTTATACNTGGTTCTGANC
TTCCTGATGTGTGTGCTANTAGTTGAACTCTGTTCCTCTGTGTGGNGGTTTNAANAGGN
Sequence Type genomic DNA
Unitrap ID UNI32121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23497179..23497716 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042208 (0610010F05Rik) NM_027860 RIKEN cDNA 0610010F05 gene Gene [Source:MGI Symbol;Acc:MGI:1918925]

 
Come back to gene ENSMUSG00000042208


For any suggestions or comments, please send an email to unitrap@crg.es