Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10318H5
Clone ID IST10318H5
Vector VICTR76
Project tigm

Sequence tag IST10318H5HMF1
Sequence
CATACATACACCAAGAAGAAAAAAAAATGGAAGAAAGTAATTTCTCCCTACTACCTCANCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI30409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20195365..20195428 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]


Sequence tag IST10318H5BBF1
Sequence
CATACNTACACNAANAANAAAAAAAAATGGAANAAAGTAATTTCTCCCTACTACCTCANCTTGGCCANANCACCCAAGTC
CCAAGTCCCANCCAATCTCCANTCACTGGAGCCAACCCACACCCGGCGTTTGCTGTACTTTTGCCCTCTCTGGCTTTCAT
GCANTTGGTATCCATTGCTGGATGACTTCTTCCCTANCACCAATCCTTACCTGGCTCCTCCTGCTGCCATCAAGTTTCCC
AAGTCTTGTGGCCCCACCCTCATTCCTGAGGCCNANGTCACTTGAANCCTTCATTGTGATAATTANAAAACAATCTTGGG
AAGTANCGTANGAATCCTGANCATGCGGTTTTTCTGTGTCTNATGCAACCCAGGCTGATATTAAACTCACAGANATCCNN
NGGCTTCTGCTGGGATTAAAGGCACGGGCCACCNNCCCAGGCCTGGCTAAGGCCNTTTCATTTTTCTTTGCTTTNNCATC
AAATTCNNNACAGCAGGCANGANCATTGTTTCTCCTTTTACNAAAACNNNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es