Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11468C11
Clone ID IST11468C11
Vector VICTR76
Project tigm

Sequence tag IST11468C11HMR1
Sequence
TANNNNACACACACCATGGCACACGGACCCACATACATGATGTGTACATACACACACAGATTTTAAAGAGAGAGAGCTGT
GGGTTAGTGTTGGGAGACGGTCTGAACTGGTGTGCCTTTGAGACAGGTAAAGCCATGCGCTCATTGGTTGGTTTCTGCAG
GAGCAGTTCCTCCAGGAGAGAATCAAGGTGAATGGGAAAGCTGGCAACCTCGGCGGAGGAGTCGTGACCATCGAACGCAG
CAAGAGCAAGATCACTGTCACTTCAGAGGTGCCTTTCTCCAAAAGGTATGAGGGGCGTGTACCTCCTGCTGTGGTGCCAG
GGCAGCGGATGAGCATGTGTGAGCAAATTGAGTTTTAGTCATGTGCATGTGTGCTCAGGTGCTCCCGAGCTGGAGCTGTC
CAGTGTAGGTGCTGGGCGCTGGACTCTGGTCCTCAAAGAGTAGTGTGTGCCTGANCCGCANCCTTCTTCTTCTTCTTTTT
TTTTTN
Sequence Type genomic DNA
Unitrap ID UNI4627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151703959..151704437 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es