Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10920G3
Clone ID IST10920G3
Vector VICTR76
Project tigm

Sequence tag IST10920G3BBF1
Sequence
GGAGGAGACCGGAGCAGGCCCCATGCCCAAGGGTAGTTGGGTAACATAAACTAGGCTAGACAAAAAGAGAAGGCAGACNA
GGAAGAGGAAGAAGACAGATTCAAAATTGAGTGGGTAGGGAGGTGAGGGTAGAGAGGGTANATGTGGGAGGAGCAGGAGG
GGGTGACTNTGATCANAATACATTGCATGATATTNTNTAAAGAATTAATAACTATTTTTAAAAGAACAATTANGAATGTT
NATANAANCAAAANCTGCCCACTGAAGACCNTGNNNGGGAAAAGCAGGGTCTCTGATGGCTGGGTATGCCNTNNNCNANN
CNNNNCAGANAACCANTTCTAANTNNTNNNGGAGTAGAAGCACATGNNANCNCNCACAGAGGCACACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10920G3HMR1
Sequence
NCCTAGCAGCTATCANATGTCAGTAGCACACTGGAGAGGTGGCTCAGAGGTTAAGAGTGCCGACTGGTCTTCCAG
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99314128..99314201 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST10920G3HMF1
Sequence
GGAGGAGACCGGNGCAGGCCCCATGCCCAAGGGTAGTTGGGTAACATAAACTAGGCTAGACAAAAAGAGAAGGCANACGA
GGAAGAGGAAGAAGACAGATTCAAAATTGAGTGGGTAGGGAGGTGAGGGTAGAGAGGGTAGATGTGGGAGGAGCAGGAGG
GGGTGACTATGATCAGAATACATTGCATGANATTCTNTAAAGAATTAATAACTATTTTTAAAAGAACAATTAGGAATGTT
NATANAANCAAAAGCTGCCCACTGAAGACCCTGNNNGGGAAAAGCANGGTCTCTGATGGCTGGGTATGCCATCACCCANN
CNGCACAGAAAACCAATTCTAACTANNAAGGGAGTAGAAGCACATGAGAACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es