Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P116D10
Clone ID P116D10
Vector ROSAbetageo0
Project ggtc

Sequence tag P116D10
Sequence
CGAGAGCAGCTGCTGCAGCGGGCCCTTCTGGCGGAGCAGGCGGAGCGCTACGACGATATGGCCTCCGCCATGAAGGCG
Sequence Type mRNA
Unitrap ID UNI641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33361726..33361803 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018965 (Ywhah) NM_011738 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide Gene [Source:MGI (curated);Acc:Ywhah-001]

 
Come back to gene ENSMUSG00000018965


For any suggestions or comments, please send an email to unitrap@crg.es