Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13247F2
Clone ID IST13247F2
Vector VICTR74
Project tigm

Sequence tag IST13247F2HMR1
Sequence
GAGTTGTTACTGTAGAGGGCCTACAAACAAGAACAGGGGTCAGAGATGAGGACCAGAGGAGGGGATGATCTAGAGGGCGT
CTCACAAATGATATGGTCACTAGGGCCCCTGAAGGATGCCTAGGAGAAGGGAGGCCAGGCCTAGGATTGAGGTTGGACCC
TCTGCGTAGCGGTCAGTGTTCTGGAGGCCTGGGGTATACTGTGTANCCTCACGGTACTACCTGGCATGGAGGAGAGTTTG
N
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287708..148287947 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST13247F2BBF1
Sequence
ACTCCTCCATCCACCTCATTTGACCAAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287678..148287711 34
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es