Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10551B11
Clone ID IST10551B11
Vector VICTR76
Project tigm

Sequence tag IST10551B11HMF1
Sequence
CTCTGAGTGACCNCNGAAGTGAGTGTACTGGGCTGCATGGCTTACTTATAAAATTACTGCACAGTAGATTCGATCTGGCT
ACTTAGGGCCCAGGACTATGCTGACTGCTGCCAAGTAGTGAGACCAAACAGTAAACTGTCTGACGGTTATAATGCCGTTC
CTTGTCAGCTGGACAACCTTCTGCCACCTCCCCTGAAGGATAAAATAGGTGAGTCTAAAAATGCACTTNNAAGAGATTAG
ATCTGTGAAGGATAAATCTCCATTTTTTATTTCTTGTAATCATTATTAAGTTTCATGAGGACACACATTACNNAACAAAT
GAAAGATATCCTTTCACAAAGGGTACTTGCCTTTATAAAATTTANGCCTTANATTATTNAAGATGATCNTGAAAGATATA
ATCTCACTGAGTTACTACNATAAGGATNAAATAATTTAGACTTGTTTTNNAAAAGTANAAATTGAAATTTTTCCTAATTT
GATTNNNGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42270277..42270760 454
 
EST/CDNA Est Name
  BI854653.1 - CX731519.1 - BG243973.1 - BB627885.1 - BB616369.1 - BU505316.1 - BB659669.1 - BE911979.1 - BB847425.1 - CJ184554.1 - CJ184895.1 - BY129926.1 - BY153129.1 - CF538084.1


Sequence tag IST10551B11HMR1
Sequence
AGAGTTGATGGTAGGTAGTGGTCGGGTAGTANTGGACTGGGCACTGGCATCTCAGTGCTAACTGCTCCATGCGTCCTCCA
GCAGTTCCCGGAGCTCTGCAGCTTGACTGCAGCCACAGGGATGGTAGACTCTCATCATCAGCTACAAGCAGCGTAGTTCT
GGAGTCAGCACACTCTGCCNTCANCANCAGTGCTGTGGCGGGGGACTGGAAGGANCTGCTGACTGTTTCCNTGTGTAAAC
TTGN
Sequence Type genomic DNA
Unitrap ID UNI29651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42270037..42270280 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]


Sequence tag IST10551B11BBF1
Sequence
CTCTGAGTGACCNCAGAAGTGAGTGTACTGGGCTGCATGGCTTACTTATAAAATTACTGCACAGTAGATTCGATCTGGCT
ACTTAGGGCCCAGGACTATGCTGACTGCTGCCAAGTAGTGAGACCAAACAGTAAACTGTCTGACGGTTATAATGCCGTTC
CTTGTCAGCTGGACAACCTTCTGCCACCTCCCCTGAAGGATAAAATAGGTGAGTCTAAAAATGCACTTANAAGAGATTAG
ATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42270277..42270522 242
 
EST/CDNA Est Name
  BY129926.1 - BY153129.1 - CF538084.1

 
Come back to gene BY129926.1 - BY153129.1 - CF538084.1


For any suggestions or comments, please send an email to unitrap@crg.es