Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10076G6
Clone ID IST10076G6
Vector VICTR75
Project tigm

Sequence tag IST10076G6BBF2
Sequence
TTCTTTAACTTCAGTAACAACCTTAACAATTCAAGGTGCCATTTTGTTTGTTTGTTTGTTTGTTTGTTTTTTCAGACTGT
GGTCTCTCTATTGTGAGTGCATATGTGTGAATATAGGCACTCATATGGGTGTGCATTACTGTGTAAATATGGATGTCAGA
AGAGGACACTGGATCCCAGGAATGTAGGGCTACAGGCATTTGTGAGCCAAACTCTGGTCCCCATTGTTTGTTTAGCAAGT
GCTCTCAACCACTGAGCCATCTCTGACACCCCAATGATACTACTTTCAAAGTCTTGCACAAACTTCTTCATTTTGACAAC
ATCCTGGATGGGCTCTAATGGCACATGGAGCAAGAACACTGGGCAGACAGCAGTGTGTGCTGCCAGTTAGAATGGCACGG
TTCATGAACTAGCACACTGCACCCTGGAGACGGACTGCAGGACCTGATGCTGCTCGTCTGCCCTTCCTGGCTTTCTGATG
CTTGGTTTTG
Sequence Type genomic DNA
Unitrap ID UNI30739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25676767..25677254 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST10076G6BBR1
Sequence
GAGCAACTATTTAAGTTACTTATTTAATTTCAGGAAAGTGGGGGGCGGGGGTTGAGAGAGATCGTGATCACGAATAAGAG
GGAGACACCCCACTTCCCCAATGGGTGCTTTAGCATGCAAAGGACGGGCACCTTTCCAAGGCCTTAAAGATATCATCTCC
AAGTGTGCCTTGAAGCTCTGGGACAAATGGCAGGTCTTCAGGACCTTTTACCATCAAAATCCTGTGAGGCCTATCTGACC
ATCTCTCCCTCTTTGCCTTTTCCTCTTGCCAAATAGTCTATCTTGTAGCATATGACTACAGTCCACTAGATATATCTTGG
TCTCTCCCTGATGGGGCCTGGCCTTCAGCCTCCCCCACACAATGGACGTCTCTCCCTCACTCTTCCCCAAGATCACCAGC
CTTCCTAAACAGTCTCTATTGTCTTTCTCTAGAAGACCCGAGCCTTGAGAAATGAGACCTAAGTTCTGGCCTTTGGTGAG
AAGACACGTTGTTGAAAACAGTATTATATTCTTAAAACTTGAGTAGAAATGTCCTGGAATCCATAATGCTTCTCTCCTCC
ACCTACGCCCTCACCATACCAAACCTATGACAGATTAAGGAGGCATGATAGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25676153..25676768 610
NO GENE  


Sequence tag IST10076G6HMF3
Sequence
TGTTGAAAAGTTCAAAGTTCAAAATCTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es