Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P116B01
Clone ID P116B01
Vector ROSAbetageo0
Project ggtc

Sequence tag P116B01
Sequence
GCTGCCGCGTCCGCCCTGCGCCTGCTCTCCTGCTTTTGCTACCCCGAGGACGAAGGTGCACAGACTTTGCCGTCAGGCTC
CTAGCTCTCCTCCCGAAGTCCGCCCCAGCGAACATG
Sequence Type mRNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143741268..143741383 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]


SPLK-Sequence tag 3SP116B01
Sequence
GAAGAGATGCCTTGNNCTGTGCCTGGACAGAAAGGCATGTCTGGCTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es