Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778D10
Clone ID IST14778D10
Vector VICTR76
Project tigm

Sequence tag IST14778D10HMF2
Sequence
GTCACAGTTAGACCACCTGGTTCACAGTCCATATCTTTGTCTGCTGCCTCCTGTTCTGTGACTTCTGTTTTCTCACCTGC
GGGATGAGGGTGAGACCGGCTCCCTCCTGTGCTGTTAGGCAGGTTGTTAAGTCAGTGCTTATGCTAGTCTCCAGCACACA
GAGAGCATCATCTCACAGGTGAGCAGCCGGGATGTAACTCAGTTGGCAGAGAGCTCACTTAGCATTCATGAACCCCCCAG
TTTGATTCCCCGGCATGATATAAACTACGCCTGGTGCATTCGGAGGGCTAGAGAGGGAGCGGCGGGGGGATCAGCAGTTC
GAGGCTAACCTGAGCTTACGTGAGATACCTACTGTAAAACTTTAATTAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79458970..79459348 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST14778D10HMR1
Sequence
TGANNNTGCTGCCTGCTCCCCCAGGACTGTCGGTGCTTCTGAGACCGAAAGCCGAAAGAAAGCCGACTGACTGGTCAGGG
CTGGGANCCCTGGGAGGTGAACTGGCACAGGAGAAAAAGTGTCCACAGCTCTGCAGCAGTGTCTAGATCTGTGGTTGGTC
CAGAGAACTTGTTAGGATTCTGATTCTCANNTCTACCCNGGACTGGGGAGAGGAGGGAGTGAATGTGGCCTGCCATCTGC
ACTTNCCAGCTGACTCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79458711..79458966 242
NO GENE  


Sequence tag IST14778D10BBF1
Sequence
AGAGCAGTCAGTGCTCTTAACCGCTGAGCCATTTCTCCAGCCCCAGTAGGCTCTTTAAAACGAAATACGACGTGATTAGT
AGGGAAAATGACTGGACCTTGGAAACAGTCAAACTGTTCATATGGGATACCGAAGCCTTACCTCATCCTACTTCTGTAAA
CACTACTTTTTTGCCCTACCTCCAACTCCTCCACCTTGAGGCTGAGCTCTTTACATTTTGAGTCTTCCTTGTTCCCCATT
CCTAGAGTCAGGTGACATCCTGAGTCATTAATGTTCTCCCCAGAGATAGTTACCACGCAAGATAATGCTGATTTTCTCCA
GGACCCACTCCTTCCACCCATCCCTGATTGCTTCTAGACTAATGACAGCAGGCCAGAANANGAGAAATAATGCCTAAAGA
TGGTGCACTGTACTCCTGGANANCNACTGAAGTGTTCTNATNACACTGGAAGTNNTTGTCATGGNTNANGTCTANNATTT
CANTGNANANNNAGGTNNNANNANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es