Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11636G6
Clone ID IST11636G6
Vector VICTR76
Project tigm

Sequence tag IST11636G6HMR1
Sequence
NTGGTAAGACNAACCCTGACCGTGGAGAGGCTGCTAGGCTTCCCTCATACAGGCCTTTAACTGCCTGTGTCTGTCTGCTC
TCTTGAAGGAAGTTTCTATGTGCTATCCATGTCCGGGTAGGAGCCAGGACTTGGGGTTCACTATCTCAGGGTTGTGTATC
TATGTATTATGGAGTTCCTCTTGAGGAAAACCTGTCTCTATCCAACCATGTGTTAAGTGTCTAATAATTTGTTCTTATCN
NCATGACTCAAAGTTATTTGTTCAGGTTGTATACTCAAATACTGCTTTTATGTTTTTGCTGAANTTCTTTANACCCNNNC
NCTCTCNTTTANTTTCTGTCTTGTTTGACACATCCCCTTNTTTNNNGGTTCTTGGTTN
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336089..148336464 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]


Sequence tag IST11636G6BBF1
Sequence
CNNGGAGAANCCCCACTGACAGACTGCTTATATCTTAAATCCGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336045..148336087 41
NO GENE  

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es