Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M118G06
Clone ID M118G06
Vector ROSAbetageo0
Project ggtc

Sequence tag M118G06
Sequence
GAATACACGCGTCCGTGGCACGGTGCGCNNGTGCNNCGAGGCATTATACCGGCCCCNNCTTCCTTCTTACCGGCACACGN
NCTGTGGTATGAGGGTGGGGACCGGCGTCAGNNTCAGGCATGNNTANNGACTACGGCACTCTCNCCGTGGTGGACGNNAT
ANNCNNCTGGGTGGGTTCGTGGCACAGTAACATACNNGAGCCGACGGGGGCGCCGGGGGGCAAGCCNNNGGCCCGGNNAG
NNNNAGGGGCCNNANGAGAGCANNAAAGGGCCGGAGGGCANNCCGCGCCACACCCCGGCCCGCAACACCCCAGAGCGAGA
AGGCGAAAAAAAATCAGCGGCGGGCNNCCGAGAACAACAAGCGGCCGAGCTTCAGCAGCCGCGACCACCCTTCACGAACC
GCGGCCTGGCCCTTCAGCGAGCGGCGGCGGCGGCGATCCGGCTTCTCTCTGCCGCCTGTGCGCCCCGTGACGCCGACAGA
GCCTTGGGTTTAGGTTGCCCGCCGCGCTTCTCACTTCTGCCGCGGGTGGAACAGCCCCGGAGGCTTCCATCCTCTTCCTG
AGGTGTCGGGGCTCGGCCCCCCGCCTCCATCTTCGCGTCTCAGGATGGCGAGCAGCAGCGGCTCCAAGGCCGAATTTATC
GTCGGTGGAAAATACAAACTGGTGCGGAAGATCGGATCTGGCTCTTTCGGGGACATTTATCTAGCGATCAACATCACCAA
TGGCGAG
Sequence Type mRNA
Unitrap ID UNI11712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61715124..61715527 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es